aileenyaril7 aileenyaril7

04-04-2014
Health

contestada

Describe what happens when blood in capillaries flows past cells

Respuesta :

06-04-2014

If the blood is carrying oxygen, the cell and the blood will have a sort of trade. The cells will give the blood the waste which will leave the body and the blood will give the cell oxygen which it needs to stay alive and continue to work.

Answer Link

Otras preguntas

How does the receptor make the organism successful in reacting to their environment?

Would someone please help me with my french? Thank you! Fill in the blank after reading the options and looking at the pictures. I will type out the options her

How would you describe neville chamberlain's policy toward hitler in the late 1930?

If you take in fewer calories than you need you have a what energy balance

Find 8 + 35 + (-76).

when she turned 18, Kaitlyn purchased 130 shares of stock A for $47 per share; 68 shares of stock B for $32 per share; 71 shares of stock C for $102 per shar

Which factor played a role in the sudden drop after 1928? A. Lack of demand B. Lack of supply C. Lack of credit D. Lack of income

help plz asap !!!!!!!!!!

Which state ratified the constitution after congress agreed to amend the constitution to include the bill of rights

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat