mohammadshoaibfazal8 mohammadshoaibfazal8
  • 03-02-2022
  • Mathematics
contestada

Suzie Chambers sells cars for a living. She carns $450 per week plus a commission of 5% on
sales. One week she sold $9600 worth of cars. How much in total did she earn for that weck?

Respuesta :

AlphaFay AlphaFay
  • 03-02-2022

Answer:

10530

Step-by-step explanation:

9600 + 450 = 10050

5% of 9600 = 480

10050 + 480 = 10530

Answer Link

Otras preguntas

CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
Why did the french revolution happen and who's fault was it
Who was the Queen of England when Shakespeare first became known as a great playwright? A. Elizabeth I B. Mary Tudor C. Victoria D. Anne Boleyn
How do I do trebuchet calculations????? Help me please
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
why is the square root of a perfect square always rational
Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate
what are 2 examples of ionic compound?
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage