Emi101 Emi101
  • 02-12-2014
  • Social Studies
contestada

do you think a single issue party could be widely accepted in the United States

Respuesta :

Аноним Аноним
  • 02-12-2014
No because if every one has to agree with one party then there would be no reason to vote because you will not have a party to debate the issue 

Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Where did middle names come from
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
31+34=90-n 45+1=70-k 6×9=41+m
Explain who or what "Año Viejo" is and its significance.
What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung
which point is in the solution set to the system of inequalities: y>2x-1 and y<1/2x+5
what is 15/24 in simplest form
In which section of his autobiography does Douglass show deep emotion? A.the expression of his affection for other slaves B. the narration of the first few y