sophiawhalen214 sophiawhalen214

01-10-2020
Mathematics

contestada

A right triangle has a leg 6 and hypotenuse of 19. Find the missing length?

Respuesta :

SukiMoon SukiMoon

01-10-2020

Answer:

18

Step-by-step explanation:

Answer Link

ricchad ricchad

01-10-2020

Answer:

18.03

Step-by-step explanation:

19² = 6² + x²

x² = 19² - 6²

x = 18.03

Answer Link

Otras preguntas

the value x+x(x×) when x = 2

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

How did the triple alliance and the triple entente change during the war?

Both Ghandhi and king set which type of mood in their introduction

Solving this question

what is x? using the picture below and directions

paul has a standard deck of cards. what is the probability he will choose a 2?

True or false? physical factors affecting community health include geography, community size, and industrial development.

You should always wear your seatbelt just in case the car comes to an abrupt stop. The seatbelt will hold you in place so that your body does not continue movin

During the song dynasty, the chinese economy expanded because question 19 options: new fishing methods created a surplus of food. song warriors destroyed the mo