alexa2585 alexa2585
  • 02-03-2020
  • Mathematics
contestada

Each cup has a height of 14 cm and the base of 3 cm.how much water is need to fill up 125 cups

Respuesta :

emilgz
emilgz emilgz
  • 02-03-2020

Answer:

12887jjojhhhuitow9w9ff

Answer Link

Otras preguntas

How did president franklin roosevelt respond to adolf hitler's attack on the soviet union in june 1941?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
With this sole proprietorship, who pays the taxes?
Which individual is correctly paired with the historical event he helped influence?
From fourteenth-century germany, the artist ________ the organic forms of the bodies of mary and jesus in order to express pain and suffering.
True or False. An object's mass will change if you move it from the Earth to the Moon.
The archetypes established in ancient mythology A. explain scientific phenomena. B. capture historical facts. C. provide ideas for improved cultural interac
Using the point-slope equation, find the equation containing (-2, -4) and slope m = -1
Plane ABC and plane BCE ____ be the same plane. Question 4 options: cannot must may
Why did some americans feel that the united states should help europe after world war ii?