Luvdinho Luvdinho

02-02-2020
Chemistry

contestada

Calculate the mass in the Gram for the following 6.00moles O2

Respuesta :

luclegault41 luclegault41

02-02-2020

Answer: 96 grams

Explanation: take the given 6.00 moles of O2 and divide it by 1 mole of O2, you then multiply that by the mass of oxygen which is 16 and that gives you 6x16=96

Answer Link

Otras preguntas

A newspaper conducted a statewide survey concerning the 1998 race for state senator. The newspaper took a SRS of =1000 registered voters and found that 520 woul

Can anyone pls help me in this pls I will mark u as brainliest

Suppose the Sun suddenly stopped emitting light. How long would it take, in seconds, for the Sun’s light to disappear on Earth? (Hint: The Sun is an average of

40. Determine the amount of time for polonium-210 to decay to one fourth its original quantity. The half-life of polonium-210 is 138 days. Please show all work.

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

Assume there is a variable, nobel_peace_prizes, that is associated with a dictionary that maps years to winners of the Nobel Peace Prize for that year and assum

Conjugate the verb "to walk" in the present in French?

the midpoint between x and 40 is 25

What is the missing constant term in the perfect square that starts with x^2-2x

Who is the President of United States of America?