shakorey shakorey
  • 01-11-2019
  • Mathematics
contestada

f(x) = x2 – 7, and g(x) = 5 – x2 then g(f(-4)) =

Respuesta :

KurdishPotato
KurdishPotato KurdishPotato
  • 01-11-2019

Step-by-step explanation:

find the value of f(-4) first

f(-4) = (-4)^2 - 7 ➡ 9 use this to find g(f(-4))

g(9) = 5 - 9^2 ➡ -76

Answer Link

Otras preguntas

How and where (at what latitudes) do atmospheric convection cells form?
Sequence the skeletal and muscular changes that take place when a person inhales
Simplify the expression completely. x squared over x to the power of 6
Why is the answer for #6 A?
Give two reasons that older adults face a greater risk of vitamin d deficiency than younger people?
4/y+2 - 9/y-2 = 9/y^2-4
The transtheoretical model includes a stage called termination. a. True b. False
Percy Bysshe Shelley's poem "Ode to the West Wind" is significant because it A. explores the human need for love and companionship. B. uses satire to make fun
The actions of the pueblo indians at santa fe in 1680 can best be described as:
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat