estercoleman5 estercoleman5

04-10-2019
Mathematics

contestada

What is the theoretical probability that you roll a 4 or 2?

Respuesta :

makkennacollins43 makkennacollins43

04-10-2019

Answer:2/6

Step-by-step explanation:

There are 6 sides to a die probability that you would roll a 2 is 1/6 and the probability that you would roll a 4 is 1/6 1/6 +1/6 =2/6

Answer Link

Otras preguntas

Which sentence best describes the main idea of a text? A.) It states the author's opinion about a different topic. B.) The important details in the text support

The relationship between kinetic energy and speed is

Name the 5 Conflict Management Styles

Please explain how to solve this :)

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU

Can you guys help me with all 3 questions please would really appreciate it.

Which best explains the meaning of the term concrete words? O A. Words that suggest abstract ideas B. Words that refer to physical objects O C. Words that invok

Please help withthe last one

Find two consecutive whole numbers that square root 120 lies between.

Convert the given for loop to while loop and find the output of the program assuming the value entered for num is 15. num = int (input ("Enter a value")) sum =