rell42 rell42
  • 03-06-2019
  • Mathematics
contestada

What is the vertex of the quadratic function f(x) = (x - 3)(x - 2)?

Respuesta :

miraclebabyboo
miraclebabyboo miraclebabyboo
  • 11-02-2022

Yhats how to get the answer, but it said I have to put words so ignore this.

Ver imagen miraclebabyboo
Ver imagen miraclebabyboo
Answer Link

Otras preguntas

What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung
4x-2y=14 y=1/2x-1 Solve the system of linear equations by substitution. Check your answer.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
The _______ system breaks down food, and the _______ system transports nutrients to the cells of the body.
in what area of Europe were the majority of warsaw pact countries
Solve the equation -10 + 3x + 5x = -56 ? ??
as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash
round 7,782 to the nearest hundred